Biotec er i Kina, ArcticZymes prisliste for kinesere

Følgende produkter fra ArcticZymes selges i Kina fra øst til vest fra nord til sør, (bruk google translate). Hele Kina har fått gleden av å kjøpe topp kvalitetsprodukter fra ArcticZymes:

Cod Uracil-DNA Glycosylase (100 units): €112.00
Cod Uracil-DNA Glycosylase (100 units): €476.00
Cod Uracil-DNA Glycosylase (2500 units): €952.00

Double-Strand Specific DNase (dsDNase) (dsDNase-2-250): €168.00
Double-Strand Specific DNase (dsDNase) (dsDNase-2-1000): €504.00
Double-Strand Specific DNase (dsDNase) (dsDNase-5-2500): €1,148.00

Heat & Run gDNA removal kit (50 Reactions): €140.00
Heat & Run gDNA removal kit (250 Reactions): €560.00

HL-dsDNase-2 (250 Units): €302.40
HL-dsDNase-2 (1000 Units): €907.20
HL-dsDNase-2 (2500 Units): €2,044.00

PCR Decontamination Kit (100 Reactions): €112.00
Salt Active Nuclease (70900-201): €140.00
Salt Active Nuclease (70900-202): €462.00
Shrimp Alkaline Phosphatase (1000units) €112.00
Shrimp Alkaline Phosphatase (5000units): €448.00

Vi husker dette:
(Tromsø 13. December 2018) Biotec Pharmacon’s (OSE: Biotec) subsidiary ArcticZymes has signed a supply agreement with a major Japanese company for its product Cod UNG.

In addition, the company has agreed to channel ArticZymes’ enzyme as a stand-alone product to its own existing customers, with specific focus on the Chinese market where it has identified a need.

ArcticZymes må ha fantastiske produkter når japanere valgte lille Biotec. Det sies at små bekker blir store elver og Biotec kommer til å tjene fantastiske summer etter hvert. Dette er en annen nettside på kinesisk med komplett beskrivelse av ulike produkter fra ArticZymes, de har salgsagenter som dekker hele Kina, og som alle andre sier de dette om ArcticZymes :
" ArcticZymes is a high-tech company dedicated to the extraction of cold-tolerant biochemical reagents from cold deep-sea species for molecular biology and diagnostic reagents, and is a leader in this field. .... It is suitable for perfect DNA removal under various conditions such as PCR and RNA extraction. Reaction (high salt, low temperature, etc.)..... Bruk google translate som vil gi en brukbar oversettelse

Husk at Kinas biotek industri er lite utviklet og de satser stort nå. Kinesere har kjøpt mange selskaper innen IT, bil, gruve..... for å utvikle sin egen industri. I tiden fremover kommer de til å kjøpe verdens ledende biotek selskaper. Biotec blinker som en stjerne mot kinesere. Uansett har kinesere stort behov for medisinske enzymer nå og i tiden fremover og Biotec kan få store salgsinntekter fra dette landet. I Kina bor ca. 1.400.000.000 mennesker:

02 Aug 2018
China's biotech revolution
The rapid rise of China’s nascent biomedicine capability shows how policy support and regulatory reform can transform an industry and rally the capital necessary to grow it.

Artig å lese at en inder anbefaler Arcticzymes's dsDNase til en kineser på nettforum. Det ser sånn ut at Arcticzymes er mer kjent ut i verden enn i Norge :

ArcticZymes med sine enzymer kan også bli like viktig som onkolytiske virus innen kreftbehandlingen. Jeg kjøpte Biotec pga av ArcticZymes og den nye sjefen. Han forklarer problemene og nøkkelen til suksess så fettfattig at en som meg med minimal Biotek kunnskap forstår. Han sa at kreftsatsingen er en langsiktig plan, heller ikke PCIB eller TRVX skal tjene noe før 2023. Phase II/III effektivitet resultatet (neuroblastoma cancer) skal komme 2020 – 2021 og de sier at "Possible approval of combined treatment for relapsed neuroblastoma". Få tror at Biotec skal tjene store summer i milliardklassen fra dette men med suksess vil Biotec blinke som er stjerne mot big pharma som betaler store summer for å ligge et skritt foran sine konkurrenter innen kreftbehandling.

side 9

Her lese vi at forskere bruke produkt fra ArcticZymes for behandling av colorectal cancer:

Comprehensive evaluation of coding region point mutations in microsatellite‐unstable *****colorectal cancer
Microsatellite instability (MSI) leads to accumulation of an excessive number of mutations in the genome, mostly small insertions and deletions. MSI colorectal cancers (CRCs), however, also contain more point mutations than microsatellite‐stable (MSS) tumors, yet they have not been as comprehensively studied...................................................................................

Sanger sequencing
To study the validity of the hot spot mutation appearing in ZNF419 in the MiSeq data (Dataset EV3), Sanger sequencing of the region was performed. The change was found in a region challenging to replicate due to sequence homology. In the resulting Sanger sequences, the change was observed in both tumors and normals, and therefore was deemed not somatic.

PCR fragments were amplified with Phusion enzyme (Thermo Fisher Scientific, Waltham, MA). Purification of the PCR products was performed with the ExoSAP‐IT PCR purification kit (USB Corporation, Cleveland, OH) or************* A'SAP PCR cleanup kit (Arctic Zymes, Tromsø, Norway)***********, and the sequencing reactions were performed with the BigDye Terminator v.3.1 kit (Applied Biosystems) and run using 730xl DNA Analyzer (Applied Biosystems, Foster City, CA, at FIMM Genome and Technology Centre, Finland). PCR primers were designed with the Primer3 program ( with GRCh37 as the reference sequence. The primer sequences are as follows: F: AAAGGCCTTACAAGTGCAGC, R: CCACTGTGAACTTTCTGGTGT. Analysis and visualization of the sequence graphs were performed with Mutation Surveyor software (version v4.0.8; Softgenetics, State College, PA).

Enzymer og behandling av kreft:
August 28, 2018
New cancer treatment uses enzymes to boost immune system and fight back

OCTOBER 19, 2018
Scientists to improve cancer treatment effectiveness

NB: Med forbehold om feil, les linkene selv.
Redigert 08.07.2019 kl 23:32 Du må logge inn for å svare
21.01.2019 kl 21:05 4953

Hvilket er vel og bra. Men du kunne latt være å dra fram ting som åpenbart ikke har med AZ å gjøre. Det virker bare villedende og useriøst.

21.01.2019 kl 21:20 4917

Produkter fra ArticZymes har mange bruksområder og stadig skal få flere bruksområder, disse illustrerer dette. De som er ekspert på Biotec kan forklare...... Som sa små bekker blir store elver og Biotec kommer til å tjene fantastiske summer etter hvert.

Jan Raa
21.01.2019 kl 23:03 4809

I hovedinnlegget står det: "Husk at Kinas biotek industri er lite utviklet og de satser stort nå" .Siste del av setninger er korrekt, kineserne satser stort. Men det er feil at dagens kinesiske biotekindustrii er lite utviklet. Den er avansert og gjør seg i høyeste grad gjeldende i sammenligning med vestlige bedrifter i samme sektor. Mange vestlige biotekbedrifter har lagt store FoU-avdelinger til f.eks. forskningsaparken i Shanghai nettopp fordi kompetansen der er imponerende, og tilgangen på superkompetent arbeidskraft svært god. Jeg synes det derfor er imponerende at ArcticZymes har klart å få innpass i dette markedet i Kina, og jeg både håper og tror at selskapet og produktene vil bli lagt merke til og tatt i bruk innen det raskt ekspanderende diagnostikk-sektoren i landet. Når det skjer tror jeg at ArcticZymes vil måtte skifte gir.
22.01.2019 kl 06:03 4689

Det er ved siden av poenget. Det er bare useriøse som selger huset til naboen som om det var deres eget.
22.01.2019 kl 16:15 4474

Ikke mange har fått med seg at Biotec har ferdigutviklet mange medisinske enzymer og disse selges nå. De utvikler mange ulike medisinske medisinske enzymer og I tiden fremover skal flere enzymer bli klar til markedet. Med teknologiske utviklingen innen biotek er det stor behov for medisinske enzymer nå i forhold til noen få år tilbake ....... .... inntektene skal komme nå etter mange år forskning og utvikling.......

Fra Jan Raa
"eksportverdien av innholdet i dette lille glasset var høyere enn et vogntog med laks"

9. mar, 2011 06:04
Verdens beste enzym verd 3,2 mrd per gram
Innholdet i disse reagensrørene har en markedsverdi på mellom 40 og 50 millioner kroner, sier Dag Rune Gjellesvik i det han forsiktig drar kurven med millionverdier ut av fryseskapet ved bioteknologibedriften ArcticZymes AS Tromsø.

23.01.2019 kl 15:58 4209

svenskene får det til , dem har leget det første såret og 12 mil i omsetting , mange sår har ikke Wulgan legget men se på omsetting i biotec , er en skam

nå er aksjen omsatt for 15 mil
Redigert 23.01.2019 kl 16:12 Du må logge inn for å svare
23.01.2019 kl 18:34 4117

Noen som har hørt rykte om at Q4 blir med overskudd ?
23.01.2019 kl 20:27 4020


De har mange produkter og den totale omsetningen var 405.000 kroner i 3Q 2018 mens i 1Q 2018 var 1.043.000 kroner, Dette likner mest på Lien styrt selskap:

Sammenlikn deres produkter med Biotec´s høy teknologiske enzymer:

Jeg satser på enzymer og der er et godt tidspunkt å investere i Biotec nå.

Q4 bliver IKKE med overskud - det sagde Jørgensen i helt klare, utvetydige vendinger på Q3-præsentationen. Jeg forstår ikke, hvorfor folk ignorerer fakta og maler luftkasteller op.

Den nuværende opgang på lav volumen er de sædvanlige, uinformerede lykkeriddere, der ikke har hørt efter i time. Og tror Q4 vil blive det første med overskud. Q4 bliver dårligere end Q3, det er sikkert og vidst, og så sender de samme lykkeriddere aktien ned på 4 NOK igen.

Jeg tror på BIOTEC, men Q4 bliver ikke “the turning point”.
23.01.2019 kl 23:13 3912

Viss du hørte vider sa han og at det lå Ann til at omsetningsmålet for AZ ville bli nådd. DEt vil si vekst i forhold til 2017 for AZ.
Hvor mye må AZ selge for i Q4 for at 2018 skal bli like høyt som 2017 ?

Det kender jeg ikke svaret på, og jeg er også ligeglad. Jørgensen sagde, at Q4 ville blive dårligere end Q3, og det betyder forsat underskud. AZ kan vækste alt det, de vil - uden overskud er det ligemeget. “Vekst i forhold til 2017” - og hvad så? Underskud er underskud. Guidance er meget usikker, og de seneste kvartaler har alle nævnt “offset” der gør “fremtidig vækst usikker”. Dette er info fra selskabet selv, ikke en konspirationsteori som Hegnar-forum har drømt op.
24.01.2019 kl 08:37 3758

Det som ikke kan bestrides, er at AZ fortsetter og levere. Og som Jan Raa sier, markedet for deres produkter er sterkt voksende. Når vi i tillegg vet at AZ leverer produkter helt i verdenstoppen innenfor sin bransje. Så må man vel kunne regne med at veksten vil fortsette i lang tid fremover. Det ble også sagt at de fremdeles ser etter partner(e) for woulgan. Kommer det ett velrennomert firma på banen, så går kursen glatt 100% påen dag. Syns ellers det er merkelig at det ikke er større interesse rundt dette selskapet. De har ett stort antall fantastiske produkter i sin portefølje. Mens de biotec selskapene på på oslo børs med størst omsettning, er langt unna og ha ferdige produkter. Skepsisen skyldes nok i stor grad alle de dårlige avgjørelsene som har blitt tatt de siste årene. Men jeg tror de mørke årene snart er forbi, og biotec vil om ikke lenge skinne som en stjerne på OSE. Så benytt anledningen nå mens vi fremdeles har en latterlig lav kurs. Jeg tror ikke du vil angre det ett år fra nå.
24.01.2019 kl 09:18 3697

AZ må i Q4 selge for minst 9,8 mill for å ha samme salg i 2018 som i 2017. Skal de ha vekst må de selge for mer.
BG hadde i Q3 2018 salg for ca 12,5 mill og med dekningsbiddrag på ca 5 mill, "Normalen" har vel ligget på rundt 5-9 mill i salg og ca 3 mill i dekningsbiddrag.
Dersom AZ leverer omtrent samme tall for 2018 som for 2017 og BG leverer innenfor "Normalen" vil underskuddet bli på ca 2 mill i Q4.

En fin beregning, og 2 mill i underskud for Q4 ville jeg absolut betragte som fremgang. Men underskud er stadig underskud, og min anke var såmænd bare lykkeridderne, der køber BIOTEC-aktier op til Q4, fordi de tror på et overskud, som ikke kommer før tidligst Q3 2019.
24.01.2019 kl 15:08 3550

Det skal veldig lite til for at Biotec nå går med overskudd, kontantbeholdningen må absolutt ha økt.
Det som kan være litt usikker er om Devine eventuelt har fått noen fallskjerm og viss han har, er den kostnadsført i Q3 eller kommer den på Q4

Aktien falder tilbage mod 4-tallet i takt med at folk forstår, at Q4 ikke bliver godt. Det er nok i virkeligheden meget fint, for så bliver skuffelsen mindre.

Regnskabet vil givet vise forbedringer, men jeg tror stadigvæk bundlinjen vil vise et minus. For 2019 forventer jeg først en positiv bundlinje i regnskaberne, men kommer der et Q4 med større forbedringer her, så burde kursen stige, da alle vel kender de 3 tidligere regnskaber for 2018.

Overordnet håber jeg mere at Biotec kommer med nogle positive udmeldinger om ordre, ny samarbejdspartner

Regnskabet var mindre godt i Q1 og Q2, mens der i store træk var klart bedring i Q3, hvor regnskabet var tæt på at gå i plus, så måske overrasker Q4 regnskabet ved at gå i plus. Samlet bliver årsregnskabet dog et pænt minus.

Jeg afventer regnskabet før jeg vil købe yderligere op i Biotec, men for den dristige kan det måske være et godt tidspunkt at købe før...

Hvorfor skulle firmaets egen CEO garantere, at Q4 IKKE ville blive bedre end Q3, hvis der var chance for at gå i plus? Stop med at fantasere.
Redigert 26.01.2019 kl 20:50 Du må logge inn for å svare

Hvis CEO har garanteret Q4 bliver dårligere end Q3 (jeg har ikke lige set det, men betvivler ikke det er sandt), så bliver det ikke regnskabet der kan hive kursen op, men mere en "trigger" i form af nye aftaler, ordre mm.

I næste uge bliver vi klogere på Biotec og fremtiden for selskabet
Redigert 26.01.2019 kl 21:33 Du må logge inn for å svare

Nye aftaler og ordrer bliver ikke annonceret i forbindelse med et kvartalregnskab for et børsnoteret selskab. Det er sket NUL (0) gange i BIOTECs historie.
27.01.2019 kl 09:22 3038

Der tar du skammelig feil. Se på Q3 presentasjonen !
I Q3 har AZ inngått 2 nye kunde avtaler, ser du på børsmeldinger så er bare den ene meldt ettersom den er innen nytt forretningsområde.
I Q4 er det også blitt meldt 1 avtale , denne var spesiell ved at AZ blir anerkjent og markedsført sammen med sluttproduktet. AZ kan ha inngått flere ordinære avtaler uten at de er meldt.
Redigert 27.01.2019 kl 09:54 Du må logge inn for å svare

Hej oppturen. Du har ret, og jeg må præcisere: Jeg mener, at der aldrig er blevet annonceret NÆVNEVÆRDIGE aftaler pa en Q-præsentation. Alt, hvad der kan få aktiekursen til at rykke sig, vil blive meldt igennem børsmeddelelser. Det er klart, at små-aftaler godt kan komme på præsentationerne, men de er uden betydning for selskabets overlevelse, som det ser ud lige nu.

Kan ikke tolkes på annet vis enn at det er store ting på gang.

@SomSa, Hvordan tolker du denne meldingen?
25.02.2019 kl 23:34 2181


Job title: Business Development Manager Europe

Report To: Director of Global Marketing
08.07.2019 kl 23:32 986

PHO fikk avtale med kinesere, blir neste ArcticZymes? De er verdensledende innen medisinske enzymer, disse er nødvendig innen immunterapi og samtidig ønsker kinesere å skaffe nye teknologier og være uavhengig av USA og andre. Etter det som skjedde med Huawei vil kinesere gi mer gass til å skaffe mer teknologi. Det er heller ikke fare for emisjon i nær fremtid.
09.07.2019 kl 08:58 883

.....når ser vi de første salgs-tallene fra Kina..... kanskje nå i 2q?